diabetestalk.net

Human Insulin Dna Sequence

Ins Insulin [ Homo Sapiens (human) ]

Ins Insulin [ Homo Sapiens (human) ]

Data suggest early peaks in glucagon-like peptide-1 and glucagon secretion/blood level together trigger exaggerated insulinotropic response (high insulin secretion/level) to eating and consequent hypoglycaemia in patients with postprandial hypoglycaemia as a postoperative complication following Roux-en-Y gastric bypass for obesity complicated by type 2 diabetes; this retrospective cohort study was conducted in London. Studies on the susceptibility to aggregation of truncated analogs of insulin amyloidogenic core show three groups of peptides. Truncation of A13-A419 fragment shows that fibrous structures are formed by all peptides bearing (13)H-LeuTyr-OH(14). Propensity to aggregation was found for (16)H-TyrLeu-OH(17) B12-B17 fragment. Insulin secretion by pancreatic beta-cells increases after adrenalectomy for aldosterone-producing adenomas; adrenalectomy in these patients prevents primary aldosteronism; such data suggest that aldosterone excess inhibits insulin secretion by pancreatic beta-cells. This retrospective study was conducted in Japan. Continue reading >>

Understanding A Genetic Disease With The Help Of Bioinformatics

Understanding A Genetic Disease With The Help Of Bioinformatics

Teaching files French version Context: Insulin is a protein that allows sugar (glucose) to enter the body's cells (mainly liver, adipose tissue and skeletal muscle). This hormone plays a key role in the regulation of glucose levels in the blood ('hypoglycemic' effect). It is produced by the beta cells in the pancreas. Type I diabetes (insulino dependent; IDDM) is more often than not due to the absence of insulin: for various poorly understood reasons (virus, autoimmune aetiology, ...), the pancreas is no longer able to produce the protein. Type II diabetes (non insulino dependent; NIDDM) is a metabolic disease (insulin resistance). Obesity is thought to be the primary cause of type II diabetes in people who are genetically predisposed to the disease. A very rare genetic variation - rs121908261 - leads to the the production of a non functional insulin and is the cause of type I diabetes in a Norwegian family, (Molven et al., 2008). This workshop will explore how bioinformatics can help to better understand the causes of this rare genetic disorder ... and also to learn more about insulin. Activity 1: The insulin gene and the human genome Bellow is a piece of the gene sequence that encodes for the insulin protein ('wild sequence')... cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc On which of our 23 chromosomes is this gene located? Bioinformatics approach: Use the tool 'BLAT' Technical information: 'BLAT' is a bioinformatics tool for comparing a DNA sequence against the whole genome sequence (the human genome has 3 billion nucleotides). If the sequence exists, BLAT finds the sequence that is the most similar in just a few seconds. It's a bit like a small 'google map' of the human genome. * Copy the DNA sequence and paste it in the tool 'BLAT' * Click on 'subm Continue reading >>

Ins - Insulin Precursor - Homo Sapiens (human) - Ins Gene & Protein

Ins - Insulin Precursor - Homo Sapiens (human) - Ins Gene & Protein

insulin-like growth factor receptor binding Source: BHF-UCL Inferred from Physical Interaction Covers physical interactions between the gene product of interest and another molecule (or ion, or complex). More information in the GO evidence code guide Inferred from physical interactioni insulin receptor binding Source: UniProtKB Inferred from Direct Assay Used to indicate a direct assay for the function, process or component indicated by the GO term. More information in the GO evidence code guide Inferred from direct assayi protease binding Source: UniProtKB Inferred from Physical Interaction Covers physical interactions between the gene product of interest and another molecule (or ion, or complex). More information in the GO evidence code guide Inferred from physical interactioni acute-phase response Source: BHF-UCL Inferred from Direct Assay Used to indicate a direct assay for the function, process or component indicated by the GO term. More information in the GO evidence code guide Inferred from direct assayi alpha-beta T cell activation Source: UniProtKB Inferred from Direct Assay Used to indicate a direct assay for the function, process or component indicated by the GO term. More information in the GO evidence code guide Inferred from direct assayi cell-cell signaling Source: UniProtKB Inferred by Curator Used for cases where an annotation is not supported by any evidence but can be reasonably inferred by a curator from other GO annotations for which evidence is available. More information in the GO evidence code guide Inferred by curatori cellular protein metabolic process Source: Reactome cognition Source: ARUK-UCL Traceable Author Statement Used for information from review articles where the original experiments are traceable through that article and also for in Continue reading >>

Sequence Of Human Insulin Gene

Sequence Of Human Insulin Gene

Abstract The human insulin gene contains two intervening sequences, one is within the region transcribed into the 5'-untranslated segment of the mRNA and the other interrupts the C-peptide encoding region. A comparison of the human with the rat insulin genes indicates potential regulatory regions in the DNA segment preceding the gene and suggests that the ancestral form of the insulin gene had two intervening sequences. Discover the world's research 14+ million members 100+ million publications 700k+ research projects Join for free Continue reading >>

Human Insulin Genome Sequence Map, Biochemical Structure Of Insulin For Recombinant Dna Insulin

Human Insulin Genome Sequence Map, Biochemical Structure Of Insulin For Recombinant Dna Insulin

Human Insulin Genome Sequence Map, Biochemical Structure of Insulin for Recombinant DNA Insulin Author(s): Chiranjib Chakraborty , Ashish A. Mungantiwar . Departmet of Biotechnology and Medical Science, Macleods Pharmaceuticals Ltd ,3rd floor,AtlantaArcade, Moral Church Road, Andheri(East), Mumbai-400059 India. Journal Name: Mini-Reviews in Medicinal Chemistry Insulin is a essential molecule for type I diabetes that is marketed by very few companies. It is the first molecule, which was made by recombinant technology; but the commercialization process is very difficult. Knowledge about biochemical structure of insulin and human insulin genome sequence map is pivotal to large scale manufacturing of recombinant DNA Insulin. This paper reviews human insulin genome sequence map, the amino acid sequence of porcine insulin, crystal structure of porcine insulin, insulin monomer, aggregation surfaces of insulin, conformational variation in the insulin monomer, insulin X-ray structures for recombinant DNA technology in the synthesis of human insulin in Escherichia coli. Keywords: Human Insulin, DNA technology, Genome Sequence Map Title: Human Insulin Genome Sequence Map, Biochemical Structure of Insulin for Recombinant DNA Insulin Author(s):Chiranjib Chakraborty and Ashish A. Mungantiwar Affiliation:Departmet of Biotechnology and Medical Science, Macleods Pharmaceuticals Ltd ,3rd floor,AtlantaArcade, Moral Church Road, Andheri(East), Mumbai-400059 India. Keywords:Human Insulin, DNA technology, Genome Sequence Map Abstract: Insulin is a essential molecule for type I diabetes that is marketed by very few companies. It is the first molecule, which was made by recombinant technology; but the commercialization process is very difficult. Knowledge about biochemical structure of insuli Continue reading >>

Dna Code For Insulin

Dna Code For Insulin

Introduction: Below are two partial sequences of DNA bases (shown for only one strand of DNA) Sequence 1 is from a human and sequence 2 is from a cow. In both humans and cows, this sequence is part of a set of instructions for controlling the production of a protein. In this case, the sequence contains the gene to make the protein insulin. Insulin is necessary for the uptake of sugar from the blood. Without insulin, a person cannot use digest sugars the same way others can, and they have a disease called diabetes. Materials: paper, pencil, codon table Procedure: Using the DNA sequence given in table 1, make a complimentary RNA strand for the human. Write the RNA directly below the DNA strand (remember to substitute U’s for T’s in RNA). Repeat step 1 for the cow. Write the RNA directly below the DNA strand in table 2. Use the codon table in your book to determine what amino acids are assembled to make the insulin protein in both the cow and the human. Write your amino acid chain directly below the RNA sequence. Table 1 Sequence 1 Human DNA C C A T A G C A C G T T A C A A C G T G A A G G T A A RNA Amino Acids Table 2 Sequence 1 Cow DNA C C G T A G C A T G T T A C A A C G C G A A G G C A C RNA Amino Acids Analysis: 1. The DNA sequence is different for the cow and the human, but the amino acid chain produced by the sequence is almost the same. How can this happen? 2. Diabetes is a disease characterized by the inability to break down sugars. Often a person with diabetes has a defective DNA sequence that codes for the making of the insulin protein. Suppose a person has a mutation in their DNA, and the first triplet for the gene coding for insulin is C C C (instead of C C A). Determine what amino acid the new DNA triplet codes for. Will this person be diabetic? 3. What if Continue reading >>

Ep0347845a3 - Insulin Precursors, Their Preparation, And Dna Sequences, Expression Vehicles And Primers And A Process For Producing Human Insulin And Analogues - Google Patents

Ep0347845a3 - Insulin Precursors, Their Preparation, And Dna Sequences, Expression Vehicles And Primers And A Process For Producing Human Insulin And Analogues - Google Patents

New! View global litigation for patent families EP0347845A3 - Insulin precursors, their preparation, and dna sequences, expression vehicles and primers and a process for producing human insulin and analogues - Google Patents Insulin precursors, their preparation, and dna sequences, expression vehicles and primers and a process for producing human insulin and analogues EP0347845A3 EP19890111221 EP89111221A EP0347845A3 EP 0347845 A3 EP0347845 A3 EP 0347845A3 EP 19890111221 EP19890111221 EP 19890111221 EP 89111221 A EP89111221 A EP 89111221A EP 0347845 A3 EP0347845 A3 EP 0347845A3 Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.) Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.) Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.) C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans

Insulin Gene Expression Is Regulated By Dna Methylation

Insulin Gene Expression Is Regulated By Dna Methylation

Abstract Insulin is a critical component of metabolic control, and as such, insulin gene expression has been the focus of extensive study. DNA sequences that regulate transcription of the insulin gene and the majority of regulatory factors have already been identified. However, only recently have other components of insulin gene expression been investigated, and in this study we examine the role of DNA methylation in the regulation of mouse and human insulin gene expression. Methodology/Principal Findings Genomic DNA samples from several tissues were bisulfite-treated and sequenced which revealed that cytosine-guanosine dinucleotide (CpG) sites in both the mouse Ins2 and human INS promoters are uniquely demethylated in insulin-producing pancreatic beta cells. Methylation of these CpG sites suppressed insulin promoter-driven reporter gene activity by almost 90% and specific methylation of the CpG site in the cAMP responsive element (CRE) in the promoter alone suppressed insulin promoter activity by 50%. Methylation did not directly inhibit factor binding to the CRE in vitro, but inhibited ATF2 and CREB binding in vivo and conversely increased the binding of methyl CpG binding protein 2 (MeCP2). Examination of the Ins2 gene in mouse embryonic stem cell cultures revealed that it is fully methylated and becomes demethylated as the cells differentiate into insulin-expressing cells in vitro. Figures Citation: Kuroda A, Rauch TA, Todorov I, Ku HT, Al-Abdullah IH, Kandeel F, et al. (2009) Insulin Gene Expression Is Regulated by DNA Methylation. PLoS ONE 4(9): e6953. Editor: Kathrin Maedler, University of Bremen, Germany Received: April 13, 2009; Accepted: August 5, 2009; Published: September 9, 2009 Copyright: © 2009 Kuroda et al. This is an open-access article distributed und Continue reading >>

First Successful Laboratory Production Of Human Insulin Announced

First Successful Laboratory Production Of Human Insulin Announced

South San Francisco, Calif. -- September 6, 1978 -- Genentech, Inc. and City of Hope National Medical Center, a private research institution and hospital in Duarte, California today announced the successful laboratory production of human insulin using recombinant DNA technology. Insulin is a protein hormone produced in the pancreas and used in the metabolism of sugar and other carbohydrates. The synthesis of human insulin was done using a process similar to the fermentation process used to make antibiotics. The achievement may be the most significant advance in the treatment of diabetes since the development of animal insulin for human use in the 1920's. The insulin synthesis is the first laboratory production DNA technology. Recombinant DNA is the technique of combining the genes of different organisms to form a hybrid molecule. DNA (deoxyribonucleic acid), the substances genes are composed of, contains the chemical record in which genetic information is encoded. Scientists at Genentech and City of Hope inserted synthetic genes carrying the genetic code for human insulin, along with the necessary control mechanism, into an E. coli bacterial strain which is a laboratory derivative of a common bacteria found in the human intestine. Once inside the bacteria, the genes were "switched-on" by the bacteria to translate the code into either "A" or "B" protein chains found in insulin. The separate chains were then joined to construct complete insulin molecules. The development of genetically engineered human insulin was funded by Genentech. However, the work was a cooperative effort between Genentech and City of Hope. The synthesis of human insulin gene was accomplished by four scientists at City of Hope Medical Center led by Roberto Crea, Ph.D., and Keichi Itakura, Ph.D. Scien Continue reading >>

How Do We Know An Inserted Gene Does Only What It Is Supposed To Do?

How Do We Know An Inserted Gene Does Only What It Is Supposed To Do?

Articles: How GMOs Are Made GMO Basics Genes are like recipes, they tell the cell how to make a particular protein. It is the presence (or absence) of the particular protein (often an enzyme) that gives the plant, animal or microbe a trait. Insulin, for example, is a protein that helps control blood sugar in mammals. The insulin gene recipe is carried in the genome of mammals, but is not present in the genomes of animals lacking blood, nor in plants or microbes, for that matter, as they have no blood to regulate. Since the 1980s, insulin used by diabetics is made by Genetically Modified bacteria into which the human insulin gene recipe was inserted. Although the bacteria have no insulin gene themselves, they were able to read and follow the human gene recipe to make insulin identical to the insulin made by human cells. This bacterial source GM insulin is extracted from the bacterial culture medium and provided to diabetics. Genetic modification works only because all living things use the same genetic language, so a human gene—such as the insulin gene— transferred to bacteria will work the same way in the bacteria as it does in humans. Genes are composed of long stretches of DNA, which is composed of the chemical building blocks we abbreviate as a,t,c and g (Adenine, Thymine, Cytosine and Guanine, respectively). Just as in the human language English, in which out thousands of words are composed of specific sequences of 26 letters, in biology all genes in all species are made of specific sequences of the four DNA bases, a,t,c and g. The human insulin gene consists of 4044 of these bases, beginning with …atggccctgtggatgcg… at the start of the insulin recipe. When the plant, animal or microbe is ‘expressing’ a gene to make the requisite protein, it reads the DN Continue reading >>

G G U A U C G U G C A A U G U U G U A C U U C C A U U

G G U A U C G U G C A A U G U U G U A C U U C C A U U

How DNA Controls the Workings of the Cell Below are two partial sequences of DNA bases (shown for only one strand of DNA) Sequence 1 is from a human and sequence 2 is from a cow. In both humans and cows, this sequence is part of a set of instructions for controlling a bodily function. In this case, the sequence contains the gene to make the protein insulin. Insulin is necessary for the uptake of sugar from the blood. Without insulin, a person cannot use digest sugars the same way others can, and they have a disease called diabetes. Instructions: 1. Using the DNA sequence, make a complimentary RNA strand from both the human and the cow. Write the RNA directly below the DNA strand (remember to substitute U's for T's in RNA) 2. Use the codon table in your book to determine what amino acids are assembled to make the insulin protein in both the cow and the human. Write your amino acid chain directly below the RNA sequence. Sequence 1 – Human C C A T A G C A C G T T A C A A C G T G A A G G T A A RNA : G G U A U C G U G C A A U G U U G U A C U U C C A U U Amino Acids: Gly – Ile – Val – Gln – Cys – Cys – Thr – Ser - Ile Sequence 2 - Cow C C G T A G C A T G T T A C A A C G C G A A G G C A C RNA: G G C A U C G U A C A A U G U U G C G C U U C C G U G Amino Acids: Gly – Ile – Val – Gln –Cys – Cys – Ala – Ser - Val Analysis 1. Comparing the human gene to the cow gene, how many of the codons are exactly the same? ____5_______ 2. How many of the amino acids in the sequence are exactly the same? ____7____ 3. Could two humans (or two cows) have some differences in their DNA sequences for insulin, yet still make the exact same insulin proteins? Explain. They could still make the exact Continue reading >>

Gene Therapy And Genetic Engineering

Gene Therapy And Genetic Engineering

For bacteria to make insulin, where do they get the insulin gene to insert into the bacteria? -A graduate student from California Back in the 1970's scientists managed to coax bacteria into making the insulin that many people need to treat their diabetes. They did this by putting the human insulin gene into the bacteria. The insulin gene they used came from human DNA. The scientists were able to get this gene in a couple of different ways. Neither of which was very easy back in the 70's! One group managed to make it on a machine called a DNA synthesizer. Like its name sounds, this machine makes DNA. Luckily the insulin gene is small since these machines could only make small snippets of DNA. A second group managed to fish it out of human DNA. This was done by putting random pieces of human DNA into bacteria and finding the bacterium that had the insulin gene. This is really hard to do but used to be the only way to get big pieces of DNA. Nowadays, what with the human genome project, it'd be much easier. By knowing just a bit about the gene they're interested in, scientists can just go look it up on the computer. Then they can simply pluck the DNA they're interested in right out of a tube of human DNA. Of course getting the gene isn't enough. You also need to get it into bacteria and have the bacteria be able to read the gene. Then you need to purify the insulin away from the bacteria. Luckily you only asked about the first part so I'll focus on that. What I thought I'd do is go over how scientists originally got the insulin gene. Then we'll look at what they might do now in a similar situation. But first, we're going to need to go into a little background. We need to go over what genes and proteins are and how they're related. Only then will we see how scientists were a Continue reading >>

Sc128255 Insulin(ins) (bc005255) Human Untagged Clone | Origene

Sc128255 Insulin(ins) (bc005255) Human Untagged Clone | Origene

Oocyte meiosis , Regulation of autophagy , mTOR signaling pathway , Regulation of actin cytoskeleton , Insulin signaling pathway , Progesterone-mediated oocyte maturation , Type II diabetes mellitus , Type I diabetes mellitus , Maturity onset diabetes of the young , Prostate cancer After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]. *Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping. The use of this cDNA Clones has been cited in the following citations: Expression and Purification of C-Peptide Containing Insulin Using Pichia pastoris Expression System ,Baeshen, MN;Bouback, TA;Alzubaidi, MA;Bora, RS;Alotaibi, MA;Alabbas, OT;Alshahrani, SM;Aljohani, AA;Munshi, RA;Al-Hejin, A;Ahmed, MM;Redwan, EM;Ramadan, HA;Saini, KS;Baeshen, NA;, Biomed Res Int 2016 ,PubMed ID 27579308 [INS] Production of recombinant human proinsulin in the milk of transgenic mice ,Qian, X;Kraft, J;Ni, Y;Zhao, FQ;, Sci Rep Sep 2014 ,PubMed ID 25267062 [INS] Continue reading >>

Recombinant Dna

Recombinant Dna

Construction of recombinant DNA, in which a foreign DNA fragment is inserted into a plasmid vector. In this example, the gene indicated by the white color is inactivated upon insertion of the foreign DNA fragment. Recombinant DNA (rDNA) molecules are DNA molecules formed by laboratory methods of genetic recombination (such as molecular cloning) to bring together genetic material from multiple sources, creating sequences that would not otherwise be found in the genome. Recombinant DNA is possible because DNA molecules from all organisms share the same chemical structure. They differ only in the nucleotide sequence within that identical overall structure. Recombinant DNA is the general name for a piece of DNA that has been created by the combination of at least two strands. Recombinant DNA molecules are sometimes called chimeric DNA, because they can be made of material from two different species, like the mythical chimera. R-DNA technology uses palindromic sequences and leads to the production of sticky and blunt ends. The DNA sequences used in the construction of recombinant DNA molecules can originate from any species. For example, plant DNA may be joined to bacterial DNA, or human DNA may be joined with fungal DNA. In addition, DNA sequences that do not occur anywhere in nature may be created by the chemical synthesis of DNA, and incorporated into recombinant molecules. Using recombinant DNA technology and synthetic DNA, literally any DNA sequence may be created and introduced into any of a very wide range of living organisms. Proteins that can result from the expression of recombinant DNA within living cells are termed recombinant proteins. When recombinant DNA encoding a protein is introduced into a host organism, the recombinant protein is not necessarily produced. Continue reading >>

Omim Entry - * 176730 - Insulin; Ins

Omim Entry - * 176730 - Insulin; Ins

Insulin, synthesized by the beta cells of the islets of Langerhans, consists of 2 dissimilar polypeptide chains, A and B, which are linked by 2 disulfide bonds. However, unlike many other proteins, e.g., hemoglobin, made up of structurally distinct subunits, insulin is under the control of a single genetic locus; chains A and B are derived from a 1-chain precursor, proinsulin, which was discovered by Steiner and Oyer (1967). Proinsulin is converted to insulin by the enzymatic removal of a segment that connects the amino end of the A chain to the carboxyl end of the B chain. This segment is called the C (for 'connecting') peptide. The human insulin gene contains 3 exons; exon 2 encodes the signal peptide, the B chain, and part of the C-peptide, while exon 3 encodes the remainder of the C-peptide and the A chain (Steiner and Oyer, 1967). The rat, mouse, and at least 3 fish species have 2 insulin genes (Lomedico et al., 1979). The single human insulin gene corresponds to rat gene II; each has 2 introns at corresponding positions. Deltour et al. (1993) showed that in the mouse embryo the 2 proinsulin genes are regulated independently, at least in part. The existence of a single insulin gene in man is supported by the findings in patients with mutations. The greatest variation among species is in the C-peptide. Receptor binding parts have been highly conserved. Some of these sites are involved with insulin-like activity, some with growth-factor activity, and some with both. INS-IGF2 Spliced Read-Through Transcripts By EST database analysis and RT-PCR, Monk et al. (2006) identified 2 read-through transcripts, which they called the INSIGF long and short isoforms, that contain exons from both the INS gene and the downstream IGF2 gene (147470). The INSIGF short isoform contains Continue reading >>

More in insulin