diabetestalk.net

Insulin Gene Size

Sc128255 Insulin(ins) (bc005255) Human Untagged Clone | Origene

Sc128255 Insulin(ins) (bc005255) Human Untagged Clone | Origene

Oocyte meiosis , Regulation of autophagy , mTOR signaling pathway , Regulation of actin cytoskeleton , Insulin signaling pathway , Progesterone-mediated oocyte maturation , Type II diabetes mellitus , Type I diabetes mellitus , Maturity onset diabetes of the young , Prostate cancer After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]. *Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping. The use of this cDNA Clones has been cited in the following citations: Expression and Purification of C-Peptide Containing Insulin Using Pichia pastoris Expression System ,Baeshen, MN;Bouback, TA;Alzubaidi, MA;Bora, RS;Alotaibi, MA;Alabbas, OT;Alshahrani, SM;Aljohani, AA;Munshi, RA;Al-Hejin, A;Ahmed, MM;Redwan, EM;Ramadan, HA;Saini, KS;Baeshen, NA;, Biomed Res Int 2016 ,PubMed ID 27579308 [INS] Production of recombinant human proinsulin in the milk of transgenic mice ,Qian, X;Kraft, J;Ni, Y;Zhao, FQ;, Sci Rep Sep 2014 ,PubMed ID 25267062 [INS] Continue reading >>

Understanding A Genetic Disease With The Help Of Bioinformatics

Understanding A Genetic Disease With The Help Of Bioinformatics

Teaching files French version Context: Insulin is a protein that allows sugar (glucose) to enter the body's cells (mainly liver, adipose tissue and skeletal muscle). This hormone plays a key role in the regulation of glucose levels in the blood ('hypoglycemic' effect). It is produced by the beta cells in the pancreas. Type I diabetes (insulino dependent; IDDM) is more often than not due to the absence of insulin: for various poorly understood reasons (virus, autoimmune aetiology, ...), the pancreas is no longer able to produce the protein. Type II diabetes (non insulino dependent; NIDDM) is a metabolic disease (insulin resistance). Obesity is thought to be the primary cause of type II diabetes in people who are genetically predisposed to the disease. A very rare genetic variation - rs121908261 - leads to the the production of a non functional insulin and is the cause of type I diabetes in a Norwegian family, (Molven et al., 2008). This workshop will explore how bioinformatics can help to better understand the causes of this rare genetic disorder ... and also to learn more about insulin. Activity 1: The insulin gene and the human genome Bellow is a piece of the gene sequence that encodes for the insulin protein ('wild sequence')... cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc On which of our 23 chromosomes is this gene located? Bioinformatics approach: Use the tool 'BLAT' Technical information: 'BLAT' is a bioinformatics tool for comparing a DNA sequence against the whole genome sequence (the human genome has 3 billion nucleotides). If the sequence exists, BLAT finds the sequence that is the most similar in just a few seconds. It's a bit like a small 'google map' of the human genome. * Copy the DNA sequence and paste it in the tool 'BLAT' * Click on 'subm Continue reading >>

Insulin Facts, Information, Pictures | Encyclopedia.com Articles About Insulin

Insulin Facts, Information, Pictures | Encyclopedia.com Articles About Insulin

Insulin is a hormone that regulates the amount of glucose (sugar) in the blood and is required for the body to function normally. Insulin is produced by cells in the pancreas, called the islets of Langerhans. These cells continuously release a small amount of insulin into the body, but they release surges of the hormone in response to a rise in the blood glucose level. Certain cells in the body change the food ingested into energy, or blood glucose, that cells can use. Every time a person eats, the blood glucose rises. Raised blood glucose triggers the cells in the islets of Langerhans to release the necessary amount of insulin. Insulin allows the blood glucose to be transported from the blood into the cells. Cells have an outer wall, called a membrane, that controls what enters and exits the cell. Researchers do not yet know exactly how insulin works, but they do know insulin binds to receptors on the cell's membrane. This activates a set of transport molecules so that glucose and proteins can enter the cell. The cells can then use the glucose as energy to carry out its functions. Once transported into the cell, the blood glucose level is returned to normal within hours. Without insulin, the blood glucose builds up in the blood and the cells are starved of their energy source. Some of the symptoms that may occur include fatigue, constant infections, blurred eye sight, numbness, tingling in the hands or legs, increased thirst, and slowed healing of bruises or cuts. The cells will begin to use fat, the energy source stored for emergencies. When this happens for too long a time the body produces ketones, chemicals produced by the liver. Ketones can poison and kill cells if they build up in the body over an extended period of time. This can lead to serious illness and com Continue reading >>

Ins - Insulin Precursor - Homo Sapiens (human) - Ins Gene & Protein

Ins - Insulin Precursor - Homo Sapiens (human) - Ins Gene & Protein

insulin-like growth factor receptor binding Source: BHF-UCL Inferred from Physical Interaction Covers physical interactions between the gene product of interest and another molecule (or ion, or complex). More information in the GO evidence code guide Inferred from physical interactioni insulin receptor binding Source: UniProtKB Inferred from Direct Assay Used to indicate a direct assay for the function, process or component indicated by the GO term. More information in the GO evidence code guide Inferred from direct assayi protease binding Source: UniProtKB Inferred from Physical Interaction Covers physical interactions between the gene product of interest and another molecule (or ion, or complex). More information in the GO evidence code guide Inferred from physical interactioni acute-phase response Source: BHF-UCL Inferred from Direct Assay Used to indicate a direct assay for the function, process or component indicated by the GO term. More information in the GO evidence code guide Inferred from direct assayi alpha-beta T cell activation Source: UniProtKB Inferred from Direct Assay Used to indicate a direct assay for the function, process or component indicated by the GO term. More information in the GO evidence code guide Inferred from direct assayi cell-cell signaling Source: UniProtKB Inferred by Curator Used for cases where an annotation is not supported by any evidence but can be reasonably inferred by a curator from other GO annotations for which evidence is available. More information in the GO evidence code guide Inferred by curatori cellular protein metabolic process Source: Reactome cognition Source: ARUK-UCL Traceable Author Statement Used for information from review articles where the original experiments are traceable through that article and also for in Continue reading >>

Sequence Of Human Insulin Gene

Sequence Of Human Insulin Gene

Abstract The human insulin gene contains two intervening sequences, one is within the region transcribed into the 5'-untranslated segment of the mRNA and the other interrupts the C-peptide encoding region. A comparison of the human with the rat insulin genes indicates potential regulatory regions in the DNA segment preceding the gene and suggests that the ancestral form of the insulin gene had two intervening sequences. Discover the world's research 14+ million members 100+ million publications 700k+ research projects Join for free Continue reading >>

Linkage Disequilibrium In The Insulin Gene Region: Size Variation At The 5' Flanking Polymorphism And Bimodality Among

Linkage Disequilibrium In The Insulin Gene Region: Size Variation At The 5' Flanking Polymorphism And Bimodality Among "class I" Alleles.

Type: Research Support, U.S. Gov't, P.H.S., Research Support, Non-U.S. Gov't, research-article, Journal Article The 5' flanking polymorphism (5'FP), a hypervariable region at the 5' end of the insulin gene, has "class 1" alleles (650-900 bp long) that are in positive linkage disequilibrium with insulin-dependent diabetes mellitus (IDDM). We report that precise sizing of the 5'FP yields a bimodal frequency distribution of class 1 allele lengths. Class 1 alleles belonging to the lower component (650-750 bp) of the bimodal distribution were somewhat more highly associated with IDDM than were alleles from the upper component (760-900 bp), but the difference was not statistically significant. We also examined 5'FP length variation in relation to allelic variation at nearby polymorphisms. At biallelic RFLPs on both sides of the 5'FP, we found that one allele exhibits near-total association with the upper component of the 5'FP class 1 distribution. Such associations represent a little-known but potentially widespread form of linkage disequilibrium. In this type of disequilibrium, a flanking allele has near-complete association with a single mode of VNTR alleles whose lengths represent consecutive numbers of tandem repeats (CNTR). Such extreme disequilibrium between a CNTR mode and flanking alleles may originate and persist because length mutations at some VNTR loci usually add or delete only one or two repeat units. Continue reading >>

Insulin-gene Flanking Sequences, Diabetes Mellitus And Atherosclerosis: A Review

Insulin-gene Flanking Sequences, Diabetes Mellitus And Atherosclerosis: A Review

, Volume 28, Issue8 , pp 556564 | Cite as Insulin-gene flanking sequences, diabetes mellitus and atherosclerosis: a review A highly polymorphic locus flanking the human insulin gene contains two major size classes of DNA restriction fragments, which segregate in families as stable genetic elements. The L-allele, i.e. fragments with an average size of about 600 base-pairs seems to be a weak genetic marker for Type 1 (insulin-dependent) diabetes mellitus, whereas the Uallele, i. e. fragments of an average size of about 2500 basepairs hitherto has been associated with Type 2 (non-insulin-dependent) diabetes mellitus and diabetic hypertriglyceridaemia. The most recent reports on this subject do not confirm an association between the U-allele and Type 2 diabetes. Our own studies indicate that the U-allele is a fairly strong marker for the development of atherosclerosis (relative risk for U-carriers 3.36). The putative functions of the polymorphic region in atherogenesis and the relation of this region to other genetic markers for atherosclerosis are not known. Insulin-geneDNA-polymorphismsdiabetes mellitusatherosclerosisgenetic markersmolecular genetics Editorial (1984) Molecular genetics for the clinician. Lancet 1: 257259 Google Scholar Sanger F (1959) Chemistry of insulin. Science 129: 13401344 CrossRef PubMed Google Scholar Bell GI, Pictet RL, Rutter WJ, Cordell B, Tischer E, Goodman HM (1980) Sequence of the human insulin gene. Nature 284: 2632 CrossRef PubMed Google Scholar Owerbach D, Bell GI, Rutter WJ, Brown JA, Shows TB (1981) The insulin gene is located on the short arm of chromosome 11 in humans. Diabetes 30: 267270 CrossRef PubMed Google Scholar Harper ME, Ullrich A, Saunders GF (1981) Localization of the human insulin gene to the distal end of the short arm of Continue reading >>

Ins Gene - Genecards | Ins Protein | Ins Antibody

Ins Gene - Genecards | Ins Protein | Ins Antibody

Hyperproinsulinemia (HPRI) [MIM:616214]: An autosomal dominant condition characterized by elevated levels of serum proinsulin-like material. {ECO:0000269 PubMed:1601997, ECO:0000269 PubMed:2196279, ECO:0000269 PubMed:3470784, ECO:0000269 PubMed:4019786}. Note=The disease is caused by mutations affecting the gene represented in this entry. Diabetes mellitus, insulin-dependent, 2 (IDDM2) [MIM:125852]: A multifactorial disorder of glucose homeostasis that is characterized by susceptibility to ketoacidosis in the absence of insulin therapy. Clinical features are polydipsia, polyphagia and polyuria which result from hyperglycemia-induced osmotic diuresis and secondary thirst. These derangements result in long-term complications that affect the eyes, kidneys, nerves, and blood vessels. {ECO:0000269 PubMed:18192540}. Note=The disease is caused by mutations affecting the gene represented in this entry. Diabetes mellitus, permanent neonatal (PNDM) [MIM:606176]: A rare form of diabetes distinct from childhood-onset autoimmune diabetes mellitus type 1. It is characterized by insulin-requiring hyperglycemia that is diagnosed within the first months of life. Permanent neonatal diabetes requires lifelong therapy. {ECO:0000269 PubMed:17855560, ECO:0000269 PubMed:18162506}. Note=The disease is caused by mutations affecting the gene represented in this entry. Maturity-onset diabetes of the young 10 (MODY10) [MIM:613370]: A form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease. {ECO:0000269 PubMed:18162506, ECO:0000269 PubMed:18192540, ECO:0000269 PubMed:20226046, ECO:0000269 PubMed: Continue reading >>

Insulin

Insulin

This article is about the insulin protein. For uses of insulin in treating diabetes, see insulin (medication). Not to be confused with Inulin. Insulin (from Latin insula, island) is a peptide hormone produced by beta cells of the pancreatic islets, and it is considered to be the main anabolic hormone of the body.[5] It regulates the metabolism of carbohydrates, fats and protein by promoting the absorption of, especially, glucose from the blood into fat, liver and skeletal muscle cells.[6] In these tissues the absorbed glucose is converted into either glycogen via glycogenesis or fats (triglycerides) via lipogenesis, or, in the case of the liver, into both.[6] Glucose production and secretion by the liver is strongly inhibited by high concentrations of insulin in the blood.[7] Circulating insulin also affects the synthesis of proteins in a wide variety of tissues. It is therefore an anabolic hormone, promoting the conversion of small molecules in the blood into large molecules inside the cells. Low insulin levels in the blood have the opposite effect by promoting widespread catabolism, especially of reserve body fat. Beta cells are sensitive to glucose concentrations, also known as blood sugar levels. When the glucose level is high, the beta cells secrete insulin into the blood; when glucose levels are low, secretion of insulin is inhibited.[8] Their neighboring alpha cells, by taking their cues from the beta cells,[8] secrete glucagon into the blood in the opposite manner: increased secretion when blood glucose is low, and decreased secretion when glucose concentrations are high.[6][8] Glucagon, through stimulating the liver to release glucose by glycogenolysis and gluconeogenesis, has the opposite effect of insulin.[6][8] The secretion of insulin and glucagon into the Continue reading >>

Haplotypes Of The Imprinted Insulin Gene Are Associated With Size For Gestational Age And Umbilical Cord Igf-ii Levels

Haplotypes Of The Imprinted Insulin Gene Are Associated With Size For Gestational Age And Umbilical Cord Igf-ii Levels

Haplotypes of the imprinted insulin gene are associated with size for gestational age and umbilical cord IGF-II levels Adkins et al; licensee BioMed Central Ltd.2008 Growth FactorLogistic RegressionMajor EffectUmbilical CordCombinatorial Library To test the association between haplotypes in the insulin insulin-like growth factor 2 (IGF2) locus and both risk of small for gestational age birth and umbilical cord IGF-II levels. 207 pairs of healthy African-American full-term, newborn and mothers from Memphis, Tennessee and Jackson, Mississippi. Associations of individual SNPs and inferred haplotypes with risk of small for gestational age (SGA) birth were tested using logistic regression, and mean umbilical cord IGF-II levels were compared by ANOVA. The risk of SGA and differences in cord IGF-II were also compared according to the parental origin of haplotypes. In newborns three INS SNPs exhibited significant (p < 0.01) association with reduced SGA risk. Two of these SNPs were significantly associated with umbilical cord IGF-II levels. In the mothers, the alternate SNP alleles were associated with reduced risk of SGA. No maternal SNPs were associated with umbilical cord IGF-II levels. When analyzed according to parental origin of haplotypes, paternally transmitted haplotypes were significantly associated with risk of SGA and umbilical cord IGF-II levels, but maternally transmitted haplotypes were not significantly associated. Newborn genotypes for polymorphisms near the 5' end of the insulin gene are significantly associated with size for gestational age and umbilical cord IGF-II levels, with a major effect due to the paternally inherited allele, which is preferentially expressed due to imprinting. There is some evidence that complementary haplotypes confer reduced risk of Continue reading >>

Insulin Protein Structure

Insulin Protein Structure

The structure of insulin is different among different species of animals. However, essentially it is a protein chain that is similar in many ways among animals. Human insulin is closest in structure and function with cow (bovine) or pig (porcine) insulin. Bovine insulin differs from human in only three amino acid residues, and porcine insulin in one. Insulin from some invertebrates and even fishes can be clinically useful in humans as they possess several similarities. Insulin structure Normal insulin that is biologically active is monomeric or exists as a single molecule. It has two long amino acid chains or polypeptide chains. The chains are chain A with 21 amino acids and chain B with 30 amino acids. Two disulfide bridges (residues A7 to B7, and A20 to B19) covalently connect the chains, and chain A contains an internal disulfide bridge (residues A6 to A11). These joints are similar in all mammalian forms of insulin. When secreted insulin joins in two’s to form dimmers and then in six’s to form hexamers. This combination takes place in the presence of zinc. The peptide chains then form 2 dimensional and three dimensional forms. Each of these 3-dimensional structures have three helices and three conserved disulfide bridges. This is a basic fold. This basic fold is present in all members of the insulin peptide family. At the core or center of the molecules is a hydrophobic or “water-hating” or water repellent area. These cluster of hydrophobic residues in the center contributes to protein stability. Stability is also lent by the disulfide bridges. Surrounding its core, the monomer has two extensive nonpolar surfaces. One of them is a flat one that is aromatic and gets buried when there is a dimer formation. The other surface is more extensive and disappears whe Continue reading >>

Global Haplotype Diversity In The Human Insulin Gene Region

Global Haplotype Diversity In The Human Insulin Gene Region

Global Haplotype Diversity in the Human Insulin Gene Region 1 Department of Genetics, University of Leicester, Leicester LE1 7RH, UK 2 McDonald Institute for Archaeological Research, University of Cambridge, Cambridge CB2 3ER, UK The insulin minisatellite (INS VNTR) has been intensively analyzed due to its associations with diseases including diabetes. We have previously used patterns of variant repeat distribution in the minisatellite to demonstrate that genetic diversity is unusually great in Africans compared to non-Africans. Here we analyzed variation at 56 single nucleotide polymorphisms (SNPs) flanking the minisatellite in individuals from six populations, and we show that over 40% of the total genetic variance near the minisatellite is due to differences between Africans and non-Africans, far higher than seen in most genomic regions and consistent with differential selection acting on the insulin gene region, most likely in the non-African ancestral population. Linkage disequilibrium was lower in African populations, with evidence of clustering of historical recombination events. Analysis of haplotypes from the relatively nonrecombining region around the minisatellite revealed a star-shaped phylogeny with lineages radiating from an ancestral African-specific haplotype. These haplotypes confirmed that minisatellite lineages defined by variant repeat distributions are monophyletic in origin. These analyses provide a framework for a cladistic approach to future disease association studies of the insulin region within both African and non-African populations, and they identify SNPs which can be rapidly analyzed as surrogate markers for minisatellite lineage. The insulin minisatellite, located within the promoter of the human insulin gene, has been intensely investig Continue reading >>

Omim Entry - * 176730 - Insulin; Ins

Omim Entry - * 176730 - Insulin; Ins

Insulin, synthesized by the beta cells of the islets of Langerhans, consists of 2 dissimilar polypeptide chains, A and B, which are linked by 2 disulfide bonds. However, unlike many other proteins, e.g., hemoglobin, made up of structurally distinct subunits, insulin is under the control of a single genetic locus; chains A and B are derived from a 1-chain precursor, proinsulin, which was discovered by Steiner and Oyer (1967). Proinsulin is converted to insulin by the enzymatic removal of a segment that connects the amino end of the A chain to the carboxyl end of the B chain. This segment is called the C (for 'connecting') peptide. The human insulin gene contains 3 exons; exon 2 encodes the signal peptide, the B chain, and part of the C-peptide, while exon 3 encodes the remainder of the C-peptide and the A chain (Steiner and Oyer, 1967). The rat, mouse, and at least 3 fish species have 2 insulin genes (Lomedico et al., 1979). The single human insulin gene corresponds to rat gene II; each has 2 introns at corresponding positions. Deltour et al. (1993) showed that in the mouse embryo the 2 proinsulin genes are regulated independently, at least in part. The existence of a single insulin gene in man is supported by the findings in patients with mutations. The greatest variation among species is in the C-peptide. Receptor binding parts have been highly conserved. Some of these sites are involved with insulin-like activity, some with growth-factor activity, and some with both. INS-IGF2 Spliced Read-Through Transcripts By EST database analysis and RT-PCR, Monk et al. (2006) identified 2 read-through transcripts, which they called the INSIGF long and short isoforms, that contain exons from both the INS gene and the downstream IGF2 gene (147470). The INSIGF short isoform contains Continue reading >>

Comparative Analysis Of Insulin Gene Promoters: Implications For Diabetes Research

Comparative Analysis Of Insulin Gene Promoters: Implications For Diabetes Research

A preliminary evaluation of the relatedness of homologues can be generated from the number and relative position of introns, and these are shown in Fig. 3.[ 34 ] There are minor variations in the sizes of the introns among mammals while large dissimilarities are witnessed in the introns of chicken and zebrafish. The insulin 1 genes of rat and mouse have lost the second intron and also contain the remnant of a polydeoxyadenylate acid tract preceding the downstream direct repeat. Together, these structural features have led to the suggestion that the insulin 1 gene is a functional transposon [ 14 ]that was generated by an RNA-mediated duplication-transposition event involving a transcript of insulin 2 gene that was initiated upstream from the normal capping site. This duplication-transposition event clearly preceded separation of rat and mouse 15 million years ago. Along this evolutionary road, additional divergence has taken place resulting in rat having the two insulin genes residing about 55 Mbp apart on chromosome 1, whereas in the mouse they lie on different chromosomes, namely 6 and 7. Insulin gene intron sizes in studied species. The intron sizes (bp) are listed for all the reviewed insulin genes. The corresponding regions of the insulin protein are displayed above the exons. A, peptide A; B, peptide B; C, peptide C; P, preproinsulin leader peptide; U, untranslated. Figure is modified from ref.34. Synteny (i.e., the preserved order of genes between organisms) provides an expedient higher-level assessment of the association between homologues. The identification and annotation of genes in most genomes remains fragmentary; however, it is clear from currently available data that all of the studied insulin genes display remarkable synteny extending all the way back to Continue reading >>

Ins Insulin [ Homo Sapiens (human) ]

Ins Insulin [ Homo Sapiens (human) ]

Data suggest early peaks in glucagon-like peptide-1 and glucagon secretion/blood level together trigger exaggerated insulinotropic response (high insulin secretion/level) to eating and consequent hypoglycaemia in patients with postprandial hypoglycaemia as a postoperative complication following Roux-en-Y gastric bypass for obesity complicated by type 2 diabetes; this retrospective cohort study was conducted in London. Studies on the susceptibility to aggregation of truncated analogs of insulin amyloidogenic core show three groups of peptides. Truncation of A13-A419 fragment shows that fibrous structures are formed by all peptides bearing (13)H-LeuTyr-OH(14). Propensity to aggregation was found for (16)H-TyrLeu-OH(17) B12-B17 fragment. Insulin secretion by pancreatic beta-cells increases after adrenalectomy for aldosterone-producing adenomas; adrenalectomy in these patients prevents primary aldosteronism; such data suggest that aldosterone excess inhibits insulin secretion by pancreatic beta-cells. This retrospective study was conducted in Japan. Continue reading >>

More in diabetes